View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_10 (Length: 276)
Name: NF0179_low_10
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0179_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 41 - 178
Target Start/End: Complemental strand, 56037697 - 56037560
Alignment:
Q |
41 |
cagagagctattacttggtgattcaacggtgaaatataagtgccgatcatagaagattaataaatttggaagacacagccctaattaggacaaggaaaac |
140 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56037697 |
cagagagctattacttggtgattcaacggtgaaatataagtgccgatcatagaagattaataaatttggaagacacagccctaattaggacaaggaaaac |
56037598 |
T |
 |
Q |
141 |
aagagctttaggcccaccatattttggtttaatataca |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
56037597 |
aagagctttaggcccaccatattttggtttaatataca |
56037560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 196 - 256
Target Start/End: Complemental strand, 51216454 - 51216394
Alignment:
Q |
196 |
tttaacactatcatgcacaattcacaaggaattgttcaaaacttccagtttcgattggaag |
256 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51216454 |
tttaacactattatgcacaattcacaaggaattgttcaaaacttccagtttcgattggaag |
51216394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University