View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_11 (Length: 271)
Name: NF0179_low_11
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0179_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 83 - 252
Target Start/End: Complemental strand, 26521084 - 26520915
Alignment:
| Q |
83 |
catcaatgggaaaaccaaaagcaaaaggaaaacaccgtttagacaaattctacttcttagccaaagaacacggttaccgctgtagagcatcatggaaact |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26521084 |
catcaatgggaaaaccaaaagcaaaaggaaaacaccgtttacacaaattctacttcttagccaaagaacacggttaccgctgtagagcatcatggaaact |
26520985 |
T |
|
| Q |
183 |
cattcaactcaattcaaagttccatttcctcgaatcctcatgcgctgtcctcgacctctgtgctcctcct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
26520984 |
cattcaactcaattcaaagttccatttcctcgaatcctcatgcgctgtcctcaacctctgcgctgctcct |
26520915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 80 - 222
Target Start/End: Complemental strand, 30378547 - 30378405
Alignment:
| Q |
80 |
catcatcaatgggaaaaccaaaagcaaaaggaaaacaccgtttagacaaattctacttcttagccaaagaacacggttaccgctgtagagcatcatggaa |
179 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||| | | | | ||||||||||| |
|
|
| T |
30378547 |
catcaacaatgggtaaagcaaaagcaaaaggaaaacatcgtttagacaaatactactacttagccaaagaacacggttactgttctcgtgcatcatggaa |
30378448 |
T |
|
| Q |
180 |
actcattcaactcaattcaaagttccatttcctcgaatcctca |
222 |
Q |
| |
|
|||| ||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
30378447 |
actcgttcaaatcaattccaaattccatttcctcgaatcctca |
30378405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 996 times since January 2019
Visitors: 2242