View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_12 (Length: 256)
Name: NF0179_low_12
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0179_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 59 - 159
Target Start/End: Original strand, 11814897 - 11814996
Alignment:
Q |
59 |
acgttggaaaatacaaatgtgtagtatgtttgtaacttttgcaagccaaatgtttattatatagatataaaatacagttatagatctttatttaggcgtt |
158 |
Q |
|
|
||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
T |
11814897 |
acgttggaaaataaacttgtgtagtatctttgtaacttttgcaagccaaatgtttattatat-gatataaaatacagttatagatttttatttaggcgtt |
11814995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University