View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_15 (Length: 248)
Name: NF0179_low_15
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0179_low_15 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 165 - 248
Target Start/End: Original strand, 27131701 - 27131784
Alignment:
| Q |
165 |
tcgaggaatagttggacccattgtataagtaatatgaaataacaaaacaaaatttaaactaattattttatgcatgtgagactc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27131701 |
tcgaggaatagttggacccattgtataagtaatataaaataacaaaacaaaatttaaactaattattttatgcatgtgagactc |
27131784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 67
Target Start/End: Original strand, 27131383 - 27131422
Alignment:
| Q |
28 |
actattgtctactactattagtcttctttgttaatcacac |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27131383 |
actactgtctactactattagtcttctttgttaatcacac |
27131422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University