View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_17 (Length: 237)
Name: NF0179_low_17
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0179_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 35 - 106
Target Start/End: Complemental strand, 7423468 - 7423397
Alignment:
| Q |
35 |
cacagaccagctcgggatcagatcccgtctttgcatttatagctgtgataatcctagtttgatcataacttt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423468 |
cacaaaccagctcgggatcagatcccgtctttgcatttatagctgtgataatcctagtttgatcataacttt |
7423397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University