View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_19 (Length: 210)
Name: NF0179_low_19
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0179_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 6496266 - 6496070
Alignment:
Q |
1 |
cacaactgcaattgtagccgcatattttcgttataataaggtgttttgatgtaacatagtaaagggaaaaaggaagtataccatctatagaatcctctaa |
100 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
6496266 |
cacaactgcaattgtagccgcatatttacgttataataaggtgttca-atgtaacatagtaaagggaaaaaggaagta--ccatctatagaatcctctaa |
6496170 |
T |
 |
Q |
101 |
gatgctcattgaggataccagaaaactcaatcaccaaaactccttctccatcaaaaagtgcttcatcaaacaccaagactaatatctcatcctcttcatc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
6496169 |
gatgctcattgaggataccagaaaactcaatcaccaaaactccttctccatcaaaaagtgcttcgtcaaacaccaagactaatatctcatcctcttcatc |
6496070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 816 times since January 2019
Visitors: 2240