View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_5 (Length: 322)
Name: NF0179_low_5
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0179_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 83 - 227
Target Start/End: Original strand, 7948329 - 7948473
Alignment:
| Q |
83 |
gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948329 |
gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa |
7948428 |
T |
|
| Q |
183 |
gcagaagaacttggtgtcttatcagctgctactgatccatcaact |
227 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7948429 |
gcagaagaacttggtgttttatcagctgctactgatccatcaact |
7948473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 580 times since January 2019
Visitors: 2233