View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0179_low_5 (Length: 322)

Name: NF0179_low_5
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0179_low_5
NF0179_low_5
[»] chr3 (1 HSPs)
chr3 (83-227)||(7948329-7948473)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 83 - 227
Target Start/End: Original strand, 7948329 - 7948473
Alignment:
83 gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7948329 gagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctcctttcaaaa 7948428  T
183 gcagaagaacttggtgtcttatcagctgctactgatccatcaact 227  Q
    ||||||||||||||||| |||||||||||||||||||||||||||    
7948429 gcagaagaacttggtgttttatcagctgctactgatccatcaact 7948473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 580 times since January 2019
Visitors: 2233