View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0179_low_6 (Length: 316)
Name: NF0179_low_6
Description: NF0179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0179_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 95 - 294
Target Start/End: Original strand, 31899436 - 31899636
Alignment:
| Q |
95 |
ttcataaccttgtctcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaact----tttattc |
190 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31899436 |
ttcataaccttgtttcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaacttatatttattt |
31899535 |
T |
 |
| Q |
191 |
caaaacttatatttcttccttggatgcatgcattgcagggattacacggtgtccttcaaaattggcaacagtcccgtacagtcttttaaccttgatattg |
290 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
31899536 |
atcaactta---ttcttattatgatgcatgcattgcagggattacacggtgtccttcaaaattggcaacaatcatgtacagtcttttaaccttgatattg |
31899632 |
T |
 |
| Q |
291 |
acac |
294 |
Q |
| |
|
|||| |
|
|
| T |
31899633 |
acac |
31899636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 8e-58; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 98 - 294
Target Start/End: Original strand, 885927 - 886134
Alignment:
| Q |
98 |
ataaccttgtctcttctactgttcttccgattaaagaaagggtacctgggtaggccatcaatgccacttatatttcttcctcaacttttattccaaaact |
197 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
885927 |
ataaccttctttcttctactgttcttccgcttaaagaaaggtcacttgggtatgccatcaatgccacttatatttcttcctcaacttttattccaaaact |
886026 |
T |
 |
| Q |
198 |
tatat-----------ttcttccttggatgcatgcattgcagggattacacggtgtccttcaaaattggcaacagtcccgtacagtcttttaaccttgat |
286 |
Q |
| |
|
||||| ||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
886027 |
tatatatatcaacttattcttattatgatgcatgcattgcagggattacacggtgtccttcaaatttggcaacaatcccgtacagtcctttaaccttgat |
886126 |
T |
 |
| Q |
287 |
attgacac |
294 |
Q |
| |
|
|||||||| |
|
|
| T |
886127 |
attgacac |
886134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 256
Target Start/End: Original strand, 31660104 - 31660147
Alignment:
| Q |
213 |
gatgcatgcattgcagggattacacggtgtccttcaaaattggc |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31660104 |
gatgcatgcattgcagggattacacagtgtccctcaaaattggc |
31660147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 256
Target Start/End: Complemental strand, 31936282 - 31936239
Alignment:
| Q |
213 |
gatgcatgcattgcagggattacacggtgtccttcaaaattggc |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31936282 |
gatgcatgcattgcagggattacacagtgtccctcaaaattggc |
31936239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 31974607 - 31974566
Alignment:
| Q |
213 |
gatgcatgcattgcagggattacacggtgtccttcaaaattg |
254 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
31974607 |
gatgcatgctttgcagggattacacagtgtccctcaaaattg |
31974566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University