View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180-INSERTION-1 (Length: 244)
Name: NF0180-INSERTION-1
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0180-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 219
Target Start/End: Original strand, 2622307 - 2622522
Alignment:
| Q |
7 |
aattctaacattgtatctgttcattaatcacatatatagtttccctatctttatgttgtgtgacttctattctgatcttaatattatga---tatgtcac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2622307 |
aattctaacattgtatctgttcattaatcacatatatagttgccctatctttatgttgtgtgacttctattctgaccttaatattatgatgatatgtcac |
2622406 |
T |
 |
| Q |
104 |
catatttccgtatcctttttatgtggttttcggttttctcctatgagtactaatgatctaaaacatctgcatcaatgtaggagacacttcataatcacaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2622407 |
catatttccgtatcctttttatgtggttttcggttttctcctatgagtactaatgatctaaaacatctgcgtcaatgtaggagacacttcataatcacaa |
2622506 |
T |
 |
| Q |
204 |
agtatcgaccaacaaa |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2622507 |
agtatcgaccaacaaa |
2622522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University