View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180-INSERTION-7 (Length: 305)
Name: NF0180-INSERTION-7
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0180-INSERTION-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 138 - 302
Target Start/End: Original strand, 11951047 - 11951211
Alignment:
Q |
138 |
ataagaggggtcgcttggtttttgggagagactagttttgcttatatggctaatccaaggaaaggtatccactcttctctttgaaacttgatttttggag |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11951047 |
ataagaggggtcgcttggtttttgggagagactagttttgcttatatggctaatccaaggaaaggtatccactcttctctttgaaacttgatttttggag |
11951146 |
T |
 |
Q |
238 |
actttgaggtaaatctaagaccttctacacttgataatttattttaaactgtagttgtgactgat |
302 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
11951147 |
actttgaggtaaatctaagaccttctacacttgataatttattttaaactgtagttgcgactgat |
11951211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University