View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180_low_11 (Length: 260)
Name: NF0180_low_11
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0180_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 52 - 241
Target Start/End: Original strand, 19690615 - 19690804
Alignment:
| Q |
52 |
aacctgtgtaaagtaacagtcaattttacttgtgcaataaattgtaaaagcatgaatcatcattagtatcacagtccgtgcctgcttatattattttctc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19690615 |
aacctgtgtaaagtaacagtcaattttacttgtgcaataaattgtaaaagcatgaatcatcattagtatcacagtccgtgcctgcttatattattttctt |
19690714 |
T |
|
| Q |
152 |
aacacatgatcatttgattgtgaaattaaaacaaaaggaagaattatctactgaatgaaaacgattacatgagtactccctcccctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19690715 |
gacacatgatcatttgattgtgaaattaaaacaaaaggaagaattatctactgaatgaaaacgattacatgagtactccctcgcctatgc |
19690804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1011 times since January 2019
Visitors: 1521