View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180_low_12 (Length: 259)
Name: NF0180_low_12
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0180_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 28 - 240
Target Start/End: Complemental strand, 42187197 - 42186985
Alignment:
Q |
28 |
gacatcatcaaatcttttcaaagacattagtctggagagctatgcaagagctgttggtcggtcaggaccagttttaacaagacaagtcaaggcttaactt |
127 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42187197 |
gacatcattaaatcttttcaaagacattagtctgaagagctatgcaagagctgttggtcggtcaggaccagttttaacaagacaagtcaaggcttaactt |
42187098 |
T |
 |
Q |
128 |
ctaatatcaattatagctgaagtgtttcttatttttcttgtacctatgaatgtgagatgtatgctttcgatttttcagctgttccttggtcttctgttat |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
42187097 |
ctaatatcaattatagctgaagtgtttcttatttttcttgtacctatgaatatgagatgtatgcttccgatttttcagctgttccttggtcttctgttat |
42186998 |
T |
 |
Q |
228 |
tttgctttctgtg |
240 |
Q |
|
|
||||||||||||| |
|
|
T |
42186997 |
tttgctttctgtg |
42186985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 132 - 169
Target Start/End: Complemental strand, 42186793 - 42186756
Alignment:
Q |
132 |
tatcaattatagctgaagtgtttcttatttttcttgta |
169 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| |
|
|
T |
42186793 |
tatcaattatagctgaagtgtttcttattattcttgta |
42186756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 964 times since January 2019
Visitors: 1519