View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180_low_14 (Length: 252)
Name: NF0180_low_14
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0180_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33992992 - 33992770
Alignment:
| Q |
1 |
accagtttggttcaaagcaggatcacaaatcttctcggaaggtggtcttgactatttagggaacccaaaccttgttcatgcacaaagcatcttagcagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33992992 |
accagtttggttcaaagcaggatcacaaatcttctcggaaggtggtcttgactatttagggaacccaaaccttgttcatgcacaaagcatcttagcagta |
33992893 |
T |
 |
| Q |
101 |
ctaggtttccaagttgttctaatgggtcttgttgaaggctttcgcatcaacggtcttcctggtgtcggagagggcaacaacctctaccctggtggccaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33992892 |
ctaggtttccaagttgttctaatgggtcttgttgaaggctttcgcatcaacggtcttcctggtgtcggagagggcaacaacctctaccctggtggccaat |
33992793 |
T |
 |
| Q |
201 |
actttgaccctcttggtctagcc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33992792 |
actttgaccctcttggtctagcc |
33992770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University