View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0180_low_18 (Length: 204)

Name: NF0180_low_18
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0180_low_18
NF0180_low_18
[»] chr8 (1 HSPs)
chr8 (1-131)||(41517773-41517906)


Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 41517906 - 41517773
Alignment:
1 cttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttcttatgc- 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
41517906 cttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttcttatgct 41517807  T
100 ttttactgctt--agctttgcttgatagtataat 131  Q
    |||||||| ||  |||||||||||||||||||||    
41517806 ttttactgatttcagctttgcttgatagtataat 41517773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University