View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180_low_18 (Length: 204)
Name: NF0180_low_18
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0180_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 41517906 - 41517773
Alignment:
Q |
1 |
cttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttcttatgc- |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41517906 |
cttgcacccccatgaagttgttcttatggatgcttcaggaaactctcttctctctatgcgccgccaaagggtatcatttcctcttcatctttcttatgct |
41517807 |
T |
 |
Q |
100 |
ttttactgctt--agctttgcttgatagtataat |
131 |
Q |
|
|
|||||||| || ||||||||||||||||||||| |
|
|
T |
41517806 |
ttttactgatttcagctttgcttgatagtataat |
41517773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University