View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0180_low_8 (Length: 264)
Name: NF0180_low_8
Description: NF0180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0180_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 3660094 - 3659853
Alignment:
Q |
8 |
tgagatgaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgag |
107 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3660094 |
tgagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgag |
3659995 |
T |
 |
Q |
108 |
gagagcgttcatgat------------tatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaa |
195 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3659994 |
gagagcgttcatgatgatgatgatgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaa |
3659895 |
T |
 |
Q |
196 |
ggcaagtaattcaacctagagtgaagaagagtgtgagatttg |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3659894 |
ggcaagtaattcaacctagagtgaagaagagtgtgagatttg |
3659853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University