View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181-16-Insertion-6 (Length: 171)
Name: NF0181-16-Insertion-6
Description: NF0181-16
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181-16-Insertion-6 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 1e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 9 - 171
Target Start/End: Original strand, 12603770 - 12603932
Alignment:
| Q |
9 |
cttgtgtgtctcggctctcagggttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12603770 |
cttgtgtgtctcggctctcagggttctcggggttcatcccaagatcctctgagattctttatgttgagcttcatgctactcaccgggggcttttattggc |
12603869 |
T |
 |
| Q |
109 |
taagcagttgaatcaccatgttgttttttgtttcgcaaactcttcttcgtgttgatctccctc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12603870 |
taagcagttgaatcaccatgttgttttttgtttcgcaaactcttcttcgtgttgatctccctc |
12603932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 5e-33
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 12594854 - 12595008
Alignment:
| Q |
15 |
tgtctcggctctcagggttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggctaagca |
114 |
Q |
| |
|
||||| ||||||| || |||||| || | ||||||||||||||||||||| |||||| |||||||||| | ||| ||||||||||||||||||| | |
|
|
| T |
12594854 |
tgtcttggctctcgggcttctcgagggttatcccaagatcctctgagatttttcatgacgagcttcatgcaattcattaggggcttttattggctaagaa |
12594953 |
T |
 |
| Q |
115 |
gttgaatcaccatgttgttttttgtttcgcaaa--ctcttcttcgtgttgatctc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
12594954 |
gttgaatcaccatgttgttttttgtttcacaaactctcttctttgtgttgatctc |
12595008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.0000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 32 - 137
Target Start/End: Complemental strand, 1990757 - 1990652
Alignment:
| Q |
32 |
ttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggctaagcagttgaatcaccatgttg |
131 |
Q |
| |
|
|||||| |||||||||||| || || |||||||||| ||||||| ||||||| | |||| | |||||| ||| |||| | ||||||||||||||| || |
|
|
| T |
1990757 |
ttctcgaggttcatcccaaaattctatgagattcttaatgttgaacttcatgtaattcactagaggctttcattagctatgtagttgaatcaccatggtg |
1990658 |
T |
 |
| Q |
132 |
tttttt |
137 |
Q |
| |
|
|||||| |
|
|
| T |
1990657 |
tttttt |
1990652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 127
Target Start/End: Complemental strand, 6220162 - 6220130
Alignment:
| Q |
95 |
gggcttttattggctaagcagttgaatcaccat |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
6220162 |
gggcttttattggctaagcaattgaatcaccat |
6220130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University