View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0181-16-Insertion-6 (Length: 171)

Name: NF0181-16-Insertion-6
Description: NF0181-16
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0181-16-Insertion-6
NF0181-16-Insertion-6
[»] chr8 (2 HSPs)
chr8 (9-171)||(12603770-12603932)
chr8 (15-167)||(12594854-12595008)
[»] chr6 (1 HSPs)
chr6 (32-137)||(1990652-1990757)
[»] chr5 (1 HSPs)
chr5 (95-127)||(6220130-6220162)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 1e-82; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 9 - 171
Target Start/End: Original strand, 12603770 - 12603932
Alignment:
9 cttgtgtgtctcggctctcagggttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
12603770 cttgtgtgtctcggctctcagggttctcggggttcatcccaagatcctctgagattctttatgttgagcttcatgctactcaccgggggcttttattggc 12603869  T
109 taagcagttgaatcaccatgttgttttttgtttcgcaaactcttcttcgtgttgatctccctc 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12603870 taagcagttgaatcaccatgttgttttttgtttcgcaaactcttcttcgtgttgatctccctc 12603932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 5e-33
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 12594854 - 12595008
Alignment:
15 tgtctcggctctcagggttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggctaagca 114  Q
    ||||| ||||||| || |||||| || | ||||||||||||||||||||| ||||||  ||||||||||  | |||   ||||||||||||||||||| |    
12594854 tgtcttggctctcgggcttctcgagggttatcccaagatcctctgagatttttcatgacgagcttcatgcaattcattaggggcttttattggctaagaa 12594953  T
115 gttgaatcaccatgttgttttttgtttcgcaaa--ctcttcttcgtgttgatctc 167  Q
    |||||||||||||||||||||||||||| ||||  |||||||| |||||||||||    
12594954 gttgaatcaccatgttgttttttgtttcacaaactctcttctttgtgttgatctc 12595008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.0000000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 32 - 137
Target Start/End: Complemental strand, 1990757 - 1990652
Alignment:
32 ttctcggggttcatcccaagatcctctgagattcttcatgttgagcttcatggtactcaccgggggcttttattggctaagcagttgaatcaccatgttg 131  Q
    |||||| |||||||||||| || || |||||||||| ||||||| |||||||  | ||||  | |||||| ||| |||| | ||||||||||||||| ||    
1990757 ttctcgaggttcatcccaaaattctatgagattcttaatgttgaacttcatgtaattcactagaggctttcattagctatgtagttgaatcaccatggtg 1990658  T
132 tttttt 137  Q
    ||||||    
1990657 tttttt 1990652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 127
Target Start/End: Complemental strand, 6220162 - 6220130
Alignment:
95 gggcttttattggctaagcagttgaatcaccat 127  Q
    |||||||||||||||||||| ||||||||||||    
6220162 gggcttttattggctaagcaattgaatcaccat 6220130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University