View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181-INSERTION-11 (Length: 272)
Name: NF0181-INSERTION-11
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181-INSERTION-11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 20217161 - 20217378
Alignment:
| Q |
17 |
tcacaattgcatttgcttactaatctatcagtaatggtttgtattatttgtagatttcatttatattgaacttgctaccaattccaggttattgatttac |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
20217161 |
tcacaattgcattttcttactaatctatcagtactggtttatattatttgtagatttcatttttattgaacttgctattaatttcaggttattgatttac |
20217260 |
T |
|
| Q |
117 |
gagtatgttaacaattggaatttagagcaatggcttcacggagcaatgcggcagcatggctatcttacttgggaagcttggatgaaaattcttctggggc |
216 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
20217261 |
gagtatgttaacaatggaaatttagagcaatggcttcatggagccatgcggcagcatggctatcttacttgggaagctcggatgaaaattctt------c |
20217354 |
T |
|
| Q |
217 |
tgggaacagccaaagcgtatgctc |
240 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
20217355 |
ttggaacagccaaagcgtatgctc |
20217378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 96 - 211
Target Start/End: Complemental strand, 51063804 - 51063689
Alignment:
| Q |
96 |
aattccaggttattgatttacgagtatgttaacaattggaatttagagcaatggcttcacggagcaatgcggcagcatggctatcttacttgggaagctt |
195 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||| ||| | || || |||||||||||||| || || |||||||| |||| |||||||| ||||| || |
|
|
| T |
51063804 |
aatttcaggttgttgatttatgagtatgttaataatggaaacttggagcaatggcttcatggtgccatgcggcaatatggttatcttacatgggatgccc |
51063705 |
T |
|
| Q |
196 |
ggatgaaaattcttct |
211 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
51063704 |
ggattaaaattcttct |
51063689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 117 - 193
Target Start/End: Original strand, 45859979 - 45860055
Alignment:
| Q |
117 |
gagtatgttaacaattggaatttagagcaatggcttcacggagcaatgcggcagcatggctatcttacttgggaagc |
193 |
Q |
| |
|
|||||||| || ||| | || ||||||||||||||||| ||||| ||||| || |||||||||||||| |||||||| |
|
|
| T |
45859979 |
gagtatgtcaataatggaaacttagagcaatggcttcatggagccatgcgtcaccatggctatcttacgtgggaagc |
45860055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 878 times since January 2019
Visitors: 1513