View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181-INSERTION-9 (Length: 360)
Name: NF0181-INSERTION-9
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181-INSERTION-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 7 - 360
Target Start/End: Original strand, 27676184 - 27676537
Alignment:
| Q |
7 |
agtttctgcttatatgtatctagctatatctaccagtctagtaatgaaagatctgtgccaatgccaagcatgttgtagattttatttgcgcatgcacttg |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27676184 |
agtttctgcttatatgtatcta--tatatctaccagtctagtaatgaaagatctgtgccaatgccaagcatgttgtagattttatttgcgcatgcacttg |
27676281 |
T |
|
| Q |
107 |
tgcacgctttggctcgtgcatccacaaaaccaaaatcaccttaatattattaatttaatattttagtcaaactcaaactat--ttaatgcacttgtgttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27676282 |
tgcacgctttggctcgtgcatccacaaaaccaaaatcaccttaatattattaatttaatattttagtcaaactcaaactatagttaatgcacttgtgttg |
27676381 |
T |
|
| Q |
205 |
ttgnnnnnnncatgcaaaacgcaacgtaaacgtgccacgcgaaatgtttctgtcgttttgttcggtaactgaccatggtgcgcgtgtgtagggttttgcc |
304 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27676382 |
ttgtttttttcatgcaaaacgcaacgtaaacgtgccacgcgaaatgtttctgtcgttttgttcggtaactgaccatggtgcgcgtgtgtagggttttgcc |
27676481 |
T |
|
| Q |
305 |
caaagcgattggagatccaattggaatttgacacgtggctatatgtctaactacta |
360 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
27676482 |
caaagcgatggggaatccaattggaatatgacacgtggctatttgtccaactacta |
27676537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 836 times since January 2019
Visitors: 1512