View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181_high_5 (Length: 218)
Name: NF0181_high_5
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 39782987 - 39783118
Alignment:
| Q |
1 |
atgtcagctcaatttcagtctcgtcgatgatctctagctcctcgtcatctgattctgcagtgtgctcctctgcaggcctttcaagatcaaatttgatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39782987 |
atgtcagctcaatttcagtctcgtcgatgatctctagcccctcgtcatctgattctgcagtgtgctcctctgcaggcctttcaagatcaaatttgatttg |
39783086 |
T |
|
| Q |
101 |
agccttttctcgtccacctttataatgatgat |
132 |
Q |
| |
|
|| ||||||| |||||||||||| |||||||| |
|
|
| T |
39783087 |
agtcttttcttgtccacctttatgatgatgat |
39783118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1018 times since January 2019
Visitors: 1521