View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181_low_19 (Length: 282)
Name: NF0181_low_19
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0181_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 26 - 192
Target Start/End: Original strand, 5658206 - 5658373
Alignment:
Q |
26 |
agaccaacaagtgttatttggaggaggttaaaaccaacatttgctaatcttcataagcttaaaccattttcttatgcttaagtaagcttctaatagaaga |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5658206 |
agaccaacaagtgttatttggaggaggttaaaaccaacatttgctaatcttcataagcttaaaccattttcttatgcttaagtaagcttctaatagaaga |
5658305 |
T |
 |
Q |
126 |
atctttatagtctagttc-ccttagttttttaattcaaaacgtacataaggcataaagtcgatcaacc |
192 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5658306 |
atctttatagtctagttcatcttagttttttaattcaaaacgtacataaggcataaagtcgatcaacc |
5658373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1029 times since January 2019
Visitors: 1522