View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181_low_21 (Length: 272)
Name: NF0181_low_21
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 31980271 - 31980080
Alignment:
| Q |
32 |
attattcttcatcaagctccgacggaccccgagaacggcgcgtgggaagagactgagtgttgtatttgtcttggagaatttagagacggtgagaaactga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980271 |
attattcttcatcaagctccgacggaccccgagaacggcgcgtgggaagagactgagtgttgtatttgtcttggagaatttagagacggtgagaaactga |
31980172 |
T |
|
| Q |
132 |
aggttttaccagggtgtgaacattattttcattgtgattgtgttgataagtggttaactcatcaatctagttgtccactttgtagaggttct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980171 |
aggttttaccagggtgtgaacattattttcattgtgattgtgttgataagtggttaactcatcaatctagttgtccactttgtagaggttct |
31980080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 178
Target Start/End: Complemental strand, 35772204 - 35772136
Alignment:
| Q |
110 |
tttagagacggtgagaaactgaaggttttaccagggtgtgaacattattttcattgtgattgtgttgat |
178 |
Q |
| |
|
|||||||| |||||||| |||| || ||||| | ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
35772204 |
tttagagatggtgagaaggtgaaagtgttaccgagttgtgatcattattttcattgtgaatgtgttgat |
35772136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1143 times since January 2019
Visitors: 1526