View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0181_low_4 (Length: 397)
Name: NF0181_low_4
Description: NF0181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0181_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 132 - 382
Target Start/End: Complemental strand, 33699371 - 33699121
Alignment:
| Q |
132 |
atggcctaatagatccttctcattcaatctctgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcctaatataattag |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33699371 |
atggcctaatagatccttctcattcaatctttgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcctaatttaattag |
33699272 |
T |
|
| Q |
232 |
acaatttaaccaatttttagtcaagttatattattctagaacttttatactgcgaccgcaattgcagttagtgatcgaaatttagaactactaaaatcat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699271 |
acaatttaaccaatttttagtcaagttatattattctaaaacttttatactgcgaccgcaattgcagttagtgatcgaaatttagaactactaaaatcat |
33699172 |
T |
|
| Q |
332 |
atataaaccaaaagttgcagtgcagtggagcttaccaaaagagctttggag |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33699171 |
atataaaccaaaagttgcagtgcagtggagcttaccaaaagagctttggag |
33699121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 135 - 220
Target Start/End: Complemental strand, 33658682 - 33658597
Alignment:
| Q |
135 |
gcctaatagatccttctcattcaatctctgctcctttctcttgcaaattatctcacttataatctcttgaattcgccgcctcgcct |
220 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| ||||||||||||| |||||||||||||| |||||| | ||||||||| |
|
|
| T |
33658682 |
gcctaatagattcttctcaatcaatctctgctcctttttcttgcaaattatttcacttataatctcccgaattctctgcctcgcct |
33658597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 980 times since January 2019
Visitors: 1519