View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0182_low_10 (Length: 262)
Name: NF0182_low_10
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0182_low_10 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 33 - 262
Target Start/End: Complemental strand, 19422102 - 19421873
Alignment:
| Q |
33 |
tgtgactaacttccatattgtagattttttcaaaaactcacttatccgtttttatgtatgcttgaagctcttctactgcatcctgaccaataagagtgct |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19422102 |
tgtgactaacttcgatattgtagattttttcaaaaactcacttttccgtttttatgtatgcttgaagctcttctactgaatcctgaccaataagagtgct |
19422003 |
T |
 |
| Q |
133 |
tggaataacaaattgaaaaccaatttctttggcattatggtcaataagtatcattccaacacctccaccttgctttattgttatggctttctctcttctg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19422002 |
tggaataacaaattgaaaaccaatttctttggcattatggtcaataagtatcattccaacacctccgccttgctttattgttatggctttctctcttctg |
19421903 |
T |
 |
| Q |
233 |
ttgtcagcaaagctttcactggtgcatata |
262 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |
|
|
| T |
19421902 |
ttgtcagcaaagctttcaattgtgcatata |
19421873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 36 - 238
Target Start/End: Complemental strand, 19428863 - 19428661
Alignment:
| Q |
36 |
gactaacttccatattgtagattttttcaaaaactcacttatccgtttttatgtatgcttgaagctcttctactgcatcctgaccaataagagtgcttgg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||| |||| ||||||||| |||||||||||||| |
|
|
| T |
19428863 |
gactaacttccatattgtagattttttcaaaaactcacctatccgcttttatgtatgcttgaagcttttccactgaatcctgaccgataagagtgcttgg |
19428764 |
T |
 |
| Q |
136 |
aataacaaattgaaaaccaatttctttggcattatggtcaataagtatcattccaacacctccaccttgctttattgttatggctttctctcttctgttg |
235 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
19428763 |
aataacgaattgaaaaccaatttctttggcattatggtcaataagtatcattccaacaccaccaccttgccttactgttatggccttctctcttctgttg |
19428664 |
T |
 |
| Q |
236 |
tca |
238 |
Q |
| |
|
||| |
|
|
| T |
19428663 |
tca |
19428661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University