View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0182_low_12 (Length: 211)
Name: NF0182_low_12
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0182_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 7969229 - 7969065
Alignment:
Q |
1 |
aaactttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggatttcttaaacttgatgatgtccatctcattgaggtacttga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| |||||||| |
|
|
T |
7969229 |
aaactttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggatttcttaaacttgatgttgaccattgtcttgatgtacttga |
7969130 |
T |
 |
Q |
101 |
aggtgcctttgaaattttttcaatattttccatattagtatcacctccttcttgctttgcttgat |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
7969129 |
aggtgcctttgaaattttttcaatattttccatactagtatcacctccttcttgctttgcttgat |
7969065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 60
Target Start/End: Complemental strand, 4516243 - 4516186
Alignment:
Q |
3 |
actttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggat |
60 |
Q |
|
|
||||||||||| ||||| || || ||||| | |||||||||||| ||||||||||||| |
|
|
T |
4516243 |
actttgctatgtctatcctttccaccaaaagctcttgatactcttacaattcttggat |
4516186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University