View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0182_low_12 (Length: 211)

Name: NF0182_low_12
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0182_low_12
NF0182_low_12
[»] chr3 (1 HSPs)
chr3 (1-165)||(7969065-7969229)
[»] chr7 (1 HSPs)
chr7 (3-60)||(4516186-4516243)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 7969229 - 7969065
Alignment:
1 aaactttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggatttcttaaacttgatgatgtccatctcattgaggtacttga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||    |||| ||||||||    
7969229 aaactttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggatttcttaaacttgatgttgaccattgtcttgatgtacttga 7969130  T
101 aggtgcctttgaaattttttcaatattttccatattagtatcacctccttcttgctttgcttgat 165  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
7969129 aggtgcctttgaaattttttcaatattttccatactagtatcacctccttcttgctttgcttgat 7969065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 3 - 60
Target Start/End: Complemental strand, 4516243 - 4516186
Alignment:
3 actttgctatgcctatctttgcctccaaatgttcttgatactctcacaattcttggat 60  Q
    ||||||||||| ||||| || || ||||| | |||||||||||| |||||||||||||    
4516243 actttgctatgtctatcctttccaccaaaagctcttgatactcttacaattcttggat 4516186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University