View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0182_low_14 (Length: 209)
Name: NF0182_low_14
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0182_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 30 - 209
Target Start/End: Original strand, 12805229 - 12805408
Alignment:
| Q |
30 |
gttataatcctttgaaaggactaaacctgcatcacaaaaagagacgaccgtaattatcaaacttatgataattttcccttaaatgggttttatctttgga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12805229 |
gttataatcctttgaaaggactaaacctgcatcacaaaaagacacgaccgtaattatcaaacttatgataattttcccttaaatgggttttatctttaga |
12805328 |
T |
|
| Q |
130 |
ggttgcagcatgaacaagtaaaccaaatgacacaactttaagcttacccaaaagccccaattttcaaatagagacaaaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12805329 |
ggttgcagcatgaacaagtaaaccaaatgacacaactttaagcttacccaaaagccccaattttcaaatagagacaaaaa |
12805408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1902 times since January 2019
Visitors: 2200