View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0182_low_4 (Length: 322)
Name: NF0182_low_4
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0182_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 185 - 239
Target Start/End: Complemental strand, 7089776 - 7089722
Alignment:
| Q |
185 |
aagcttggaagcacatggtgtaaggtactaaatgtgtaattactttgtcctttat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7089776 |
aagcttggaagcacatggtgtaaggtactaaatgtgtaattactttgtcctttat |
7089722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 185 - 239
Target Start/End: Complemental strand, 7669606 - 7669552
Alignment:
| Q |
185 |
aagcttggaagcacatggtgtaaggtactaaatgtgtaattactttgtcctttat |
239 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
7669606 |
aagcttggaagcacatggtgtatggtactaaatgtgttattactttgtcttttat |
7669552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 101 - 129
Target Start/End: Complemental strand, 7089855 - 7089827
Alignment:
| Q |
101 |
cactttccctatatcactgaagcaggtaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7089855 |
cactttccctatatcactgaagcaggtaa |
7089827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University