View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0182_low_5 (Length: 314)
Name: NF0182_low_5
Description: NF0182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0182_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 100 - 224
Target Start/End: Original strand, 32062504 - 32062628
Alignment:
| Q |
100 |
caacatgtttgggaagccaatagactttgttagaaagaaaaggtcattgaagcaagagaatgcactggagaacaatagtggaaaggaattcggtgggttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32062504 |
caacatgtttgggaagccaatagactttgttagaaagaaaaggtcactgaagcaagagaatgcaccggagaacaatagtggaaaggaattcggtgggttt |
32062603 |
T |
|
| Q |
200 |
tcaatccttgccgatgatgatgatg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32062604 |
tcaatccttgccgatgatgatgatg |
32062628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 113 - 219
Target Start/End: Original strand, 32062652 - 32062758
Alignment:
| Q |
113 |
aagccaatagactttgttagaaagaaaaggtcattgaagcaagagaatgcactggagaacaatagtggaaaggaattcggtgggttttcaatccttgccg |
212 |
Q |
| |
|
||||||||||| |||||| | || ||||| | | ||||||| ||||| |||| || |||||| |||||||||||| || |||||||||| || ||||| | |
|
|
| T |
32062652 |
aagccaatagattttgttcggaaaaaaagattaatgaagcaggagaaagcaccggggaacaacagtggaaaggaactcagtgggttttcgatacttgcgg |
32062751 |
T |
|
| Q |
213 |
atgatga |
219 |
Q |
| |
|
||||||| |
|
|
| T |
32062752 |
atgatga |
32062758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1487 times since January 2019
Visitors: 2192