View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0183-INSERTION-9 (Length: 278)
Name: NF0183-INSERTION-9
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0183-INSERTION-9 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 278
Target Start/End: Complemental strand, 11252 - 10984
Alignment:
| Q |
8 |
gagtgtcctatggtgaaacaattagaacaacaataatacaatctttcgtagacgatatatcaacataaaatgcaaaaccttcgcacatcaccaacacttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11252 |
gagtgtcctatggtgaaacaattagaccaacaataatacaatctttcgtagacgatat--caacataaaatgcaaaaccttcgcgcatcaccaacacttc |
11155 |
T |
 |
| Q |
108 |
atcaaatattctctaggatatgtcaatgtcgacaagaatgccagcgtagtacctaccctgcttgatatttcaaacaatgttcttggcagccaatattctt |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11154 |
atcaaatattctctaggataggtcaatgtcgacaagaatgccagcgtagtacctaccccgcttgatatttcaaacaatgttcttggcagccaatattctt |
11055 |
T |
 |
| Q |
208 |
gggggaggtccatgattctgaacattggattgcctttgtgtgtaagggttgaaatcatgttcccactttga |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11054 |
gggggaggtccatgattctgaacattggattgcctttgtgtgtaagggttgaaatcatgttcccactttga |
10984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University