View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0183_high_9 (Length: 202)
Name: NF0183_high_9
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0183_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 29 - 188
Target Start/End: Original strand, 52409401 - 52409560
Alignment:
| Q |
29 |
ctgtcttcccccgcaagccgaaatgcataatacggcaagttttttactttatttatgttgacaaatgtatggtgtaaggcattactataagctattttaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52409401 |
ctgtcttcccccgcaagccgaaatgcataatacggcaagttttctactttatttatgttgacaaatgtatggtgtaaggcattactataagctattttaa |
52409500 |
T |
|
| Q |
129 |
taccagcttatttgtttaaatgtcaattttatgttttcaaattatttatttatgtctgtg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52409501 |
taccagcttatttgtttaaatgtcaattttatgttttcaaattatttatttatgtctgtg |
52409560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1063 times since January 2019
Visitors: 2243