View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0183_low_10 (Length: 222)
Name: NF0183_low_10
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0183_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 52409560 - 52409401
Alignment:
| Q |
18 |
cacagacataaataaataatttgaaaacataaaattgacatttaaacaaataagctggtattaaaatagcttatagtaatgccttacaccatacatttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52409560 |
cacagacataaataaataatttgaaaacataaaattgacatttaaacaaataagctggtattaaaatagcttatagtaatgccttacaccatacatttgt |
52409461 |
T |
|
| Q |
118 |
caacataaataaagtaaaaaacttgccgtattatgcatttcggcttgtgggggaagacag |
177 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52409460 |
caacataaataaagtagaaaacttgccgtattatgcatttcggcttgcgggggaagacag |
52409401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1044 times since January 2019
Visitors: 2243