View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0183_low_11 (Length: 202)

Name: NF0183_low_11
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0183_low_11
NF0183_low_11
[»] chr1 (1 HSPs)
chr1 (29-188)||(52409401-52409560)


Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 29 - 188
Target Start/End: Original strand, 52409401 - 52409560
Alignment:
29 ctgtcttcccccgcaagccgaaatgcataatacggcaagttttttactttatttatgttgacaaatgtatggtgtaaggcattactataagctattttaa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52409401 ctgtcttcccccgcaagccgaaatgcataatacggcaagttttctactttatttatgttgacaaatgtatggtgtaaggcattactataagctattttaa 52409500  T
129 taccagcttatttgtttaaatgtcaattttatgttttcaaattatttatttatgtctgtg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52409501 taccagcttatttgtttaaatgtcaattttatgttttcaaattatttatttatgtctgtg 52409560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University