View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0183_low_12 (Length: 202)
Name: NF0183_low_12
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0183_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 37957910 - 37957960
Alignment:
Q |
1 |
cactggcaattgttgttttgcctgtccctcccatgccccatattcctatga |
51 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37957910 |
cactggcaattgttgttttgcctgtccctcccatgccccatattcctatga |
37957960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 37929674 - 37929626
Alignment:
Q |
4 |
tggcaattgttgttttgcctgtccctcccatgccccatattcctatgat |
52 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
T |
37929674 |
tggcaattgttgttttgcctatccctcccatgccccgtattcctatgat |
37929626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 46
Target Start/End: Original strand, 34727847 - 34727887
Alignment:
Q |
6 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
46 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
34727847 |
gcaattgttgttttgccgatccctcccatgccccatattcc |
34727887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 46
Target Start/End: Original strand, 34731005 - 34731045
Alignment:
Q |
6 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
46 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
34731005 |
gcaattgttgttttgccgatccctcccatgccccatattcc |
34731045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 46
Target Start/End: Complemental strand, 18928879 - 18928839
Alignment:
Q |
6 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
46 |
Q |
|
|
||||||||||||||||| |||||||||| ||||||||||| |
|
|
T |
18928879 |
gcaattgttgttttgccgatccctcccataccccatattcc |
18928839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 42
Target Start/End: Original strand, 34735604 - 34735640
Alignment:
Q |
6 |
gcaattgttgttttgcctgtccctcccatgccccata |
42 |
Q |
|
|
||||||||||||||||| |||||||||||||||||| |
|
|
T |
34735604 |
gcaattgttgttttgccgatccctcccatgccccata |
34735640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University