View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0183_low_8 (Length: 300)
Name: NF0183_low_8
Description: NF0183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0183_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 77 - 299
Target Start/End: Complemental strand, 23325019 - 23324797
Alignment:
| Q |
77 |
aatcaaacggtcctagatcagtcctgcagtctctcatatcatagtacataaatctgattcgtgtttggttacaccttttgcaattgtgaaatgttgtgga |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23325019 |
aatcaaacggtcctagatcagtcctgcagtctctcatatcatagtacataaatctgattcgtgtttagttacaccttttgcaattgtgaaatgttgtgga |
23324920 |
T |
|
| Q |
177 |
gtgagtccgaatattttatctgcattaatttccatcaccaattgttannnnnnncatgtattttccggaatttcgtcattgaccttccttattaattttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23324919 |
gtgagtccgaatattttatctgcattaatttccatcaccaattgttatttttttcatgtattttccggaatttcgtcattgaccttccttattaattttg |
23324820 |
T |
|
| Q |
277 |
gacagtaattgataattaattat |
299 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23324819 |
gacagtaattgataattaattat |
23324797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 607 times since January 2019
Visitors: 2233