View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0184_low_2 (Length: 324)
Name: NF0184_low_2
Description: NF0184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0184_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 30 - 315
Target Start/End: Complemental strand, 25707483 - 25707210
Alignment:
| Q |
30 |
gcaattggacctgtagctgtagtgtctatgcttttatcttccttggtcaccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25707483 |
gcaattggacctgtagctgtagtgtctatgcttttatcttccttggtcaccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatct |
25707384 |
T |
|
| Q |
130 |
ttaccgtcaccttcttcgccggaatttttcaagctgcatttggtattttcaggtgctggttttctcattagcatgcaatatttcttgtgaatttcttgta |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25707383 |
ttaccgtcaccttcttcaccggaatttttcaagctgcatttggtattttcaggtgctggttttctcattagcatgcaaaattt------------ttgta |
25707296 |
T |
|
| Q |
230 |
aattttctgttttgcccttataaaccaaatagtttgtttatttatccttcaatattttcaggttgggttttcttgtggattttctt |
315 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25707295 |
aattttctgttttgtccttataaaccaaatagtttgtttatttatccttcaatatttacaggttgggttttcttgtggattttctt |
25707210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 846 times since January 2019
Visitors: 2240