View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0184_low_6 (Length: 238)
Name: NF0184_low_6
Description: NF0184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0184_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 4 - 132
Target Start/End: Original strand, 37978258 - 37978386
Alignment:
Q |
4 |
gaagaaacaaaggacaaaaaagcttatccacactgtgaagtcgaaaaaaggaaacccaaacctttttgttgtcgatattgtaaggagtcgctgacataat |
103 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37978258 |
gaagaaaaaaaggacaaaaaagcttatccacactgtgaagtcgaaaaaaggaaacccaaacctttttgttgtcgatattgtaaggagtcgctgacataat |
37978357 |
T |
 |
Q |
104 |
gacacgtagagatttgacattcaaaatga |
132 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
37978358 |
gacacgtagagatttgacattcaaaatga |
37978386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University