View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_12 (Length: 304)
Name: NF0185_low_12
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0185_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 80 - 210
Target Start/End: Original strand, 15643991 - 15644121
Alignment:
| Q |
80 |
agattattcttccggcgccggtcagtgagaagttgtttaagatcaagcaagatctgaagttgtttgctaagcatatcacgcctctcaagaaactcactct |
179 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15643991 |
agattatttttccggcgccggtcagtgagaagttgtttaagatcaagcaagatctgaagttgtttgctaagcatatcacgcctctcaagaaactcactct |
15644090 |
T |
|
| Q |
180 |
cttgtttcctatagaattggttcaccttatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15644091 |
cttgtttcctatagaattggttcaccttatt |
15644121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 938 times since January 2019
Visitors: 2241