View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_20 (Length: 215)
Name: NF0185_low_20
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0185_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 40546507 - 40546377
Alignment:
| Q |
1 |
gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546507 |
gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa |
40546408 |
T |
|
| Q |
101 |
gtcacaaaaattgcttttaagacaagtataa |
131 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
40546407 |
gtcacaaaaattgcttttaagacaaatataa |
40546377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1049 times since January 2019
Visitors: 2243