View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_20 (Length: 215)

Name: NF0185_low_20
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_20
NF0185_low_20
[»] chr5 (1 HSPs)
chr5 (1-131)||(40546377-40546507)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 40546507 - 40546377
Alignment:
1 gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40546507 gggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaa 40546408  T
101 gtcacaaaaattgcttttaagacaagtataa 131  Q
    ||||||||||||||||||||||||| |||||    
40546407 gtcacaaaaattgcttttaagacaaatataa 40546377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University