View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_22 (Length: 215)

Name: NF0185_low_22
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_22
NF0185_low_22
[»] chr1 (1 HSPs)
chr1 (137-211)||(34142278-34142352)
[»] chr8 (1 HSPs)
chr8 (5-38)||(7863671-7863704)


Alignment Details
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 34142352 - 34142278
Alignment:
137 atatgaacatagttgtttactccttgtactctctctaatatgctctttgtcgattgttgatctaaccatcttgcc 211  Q
    ||||||| || ||||||||||| ||||||| ||||||||||||||||||||| |||||||| | |||||||||||    
34142352 atatgaaaatggttgtttactcattgtactatctctaatatgctctttgtcgtttgttgatattaccatcttgcc 34142278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 7863704 - 7863671
Alignment:
5 ttccattggttttaggcatatcccttggagtata 38  Q
    ||||||||||||||||||||||||||||||||||    
7863704 ttccattggttttaggcatatcccttggagtata 7863671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University