View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_22 (Length: 215)
Name: NF0185_low_22
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0185_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 137 - 211
Target Start/End: Complemental strand, 34142352 - 34142278
Alignment:
| Q |
137 |
atatgaacatagttgtttactccttgtactctctctaatatgctctttgtcgattgttgatctaaccatcttgcc |
211 |
Q |
| |
|
||||||| || ||||||||||| ||||||| ||||||||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
34142352 |
atatgaaaatggttgtttactcattgtactatctctaatatgctctttgtcgtttgttgatattaccatcttgcc |
34142278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 7863704 - 7863671
Alignment:
| Q |
5 |
ttccattggttttaggcatatcccttggagtata |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7863704 |
ttccattggttttaggcatatcccttggagtata |
7863671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University