View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_30 (Length: 202)
Name: NF0185_low_30
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0185_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 29847737 - 29847850
Alignment:
Q |
1 |
ggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaactttttattggggaacatgattttaaacaacggttaaggttacgatgcaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
29847737 |
ggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaacttgttattggggaacatgattttaaaccaccgttaaggttacgatgcaaa |
29847836 |
T |
 |
Q |
101 |
cttttatattgcag |
114 |
Q |
|
|
|||||||||||||| |
|
|
T |
29847837 |
cttttatattgcag |
29847850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1136 times since January 2019
Visitors: 2244