View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_31 (Length: 202)

Name: NF0185_low_31
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_31
NF0185_low_31
[»] chr1 (1 HSPs)
chr1 (1-114)||(29847737-29847850)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 29847737 - 29847850
Alignment:
1 ggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaactttttattggggaacatgattttaaacaacggttaaggttacgatgcaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||    
29847737 ggatgtttggttgttaaggaggacaattgaaacttaagcttgcaactaacttgttattggggaacatgattttaaaccaccgttaaggttacgatgcaaa 29847836  T
101 cttttatattgcag 114  Q
    ||||||||||||||    
29847837 cttttatattgcag 29847850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University