View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_4 (Length: 374)

Name: NF0185_low_4
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_4
NF0185_low_4
[»] chr5 (1 HSPs)
chr5 (93-237)||(42467952-42468096)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 93 - 237
Target Start/End: Complemental strand, 42468096 - 42467952
Alignment:
93 aacaggaagaaaccaaaggtactaaaattaagattttatagatagatacatgttatctgtagtgcttcctacaaactttaaggctgatggctgaactatc 192  Q
    |||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42468096 aacaagaagaaactaaaggtactaaaattaagattttattgatagatacatgttatctgtagtgcttcctacaaactttaaggctgatcgctgaactatc 42467997  T
193 ccccgaactatttctatattcagtttagttcatatgcaacgtaca 237  Q
    ||||||||||||||||||||||||||||||| |||||||||||||    
42467996 ccccgaactatttctatattcagtttagttcgtatgcaacgtaca 42467952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University