View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_4 (Length: 374)
Name: NF0185_low_4
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0185_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 93 - 237
Target Start/End: Complemental strand, 42468096 - 42467952
Alignment:
Q |
93 |
aacaggaagaaaccaaaggtactaaaattaagattttatagatagatacatgttatctgtagtgcttcctacaaactttaaggctgatggctgaactatc |
192 |
Q |
|
|
|||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
42468096 |
aacaagaagaaactaaaggtactaaaattaagattttattgatagatacatgttatctgtagtgcttcctacaaactttaaggctgatcgctgaactatc |
42467997 |
T |
 |
Q |
193 |
ccccgaactatttctatattcagtttagttcatatgcaacgtaca |
237 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
42467996 |
ccccgaactatttctatattcagtttagttcgtatgcaacgtaca |
42467952 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University