View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_5 (Length: 351)

Name: NF0185_low_5
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_5
NF0185_low_5
[»] chr1 (2 HSPs)
chr1 (36-99)||(40293497-40293560)
chr1 (219-278)||(40293406-40293465)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 36 - 99
Target Start/End: Complemental strand, 40293560 - 40293497
Alignment:
36 agttgtaccgttatgttactttggttgatccagcctgcaatcaattcgaatattatgcgtatac 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40293560 agttgtaccgttatgttactttggttgatccagcctgcaatcaattcgaatattatgcgtatac 40293497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 40293465 - 40293406
Alignment:
219 gtttttgtttgtttgacgcgcatcaatatgaactattgccatacacgtattatagaataa 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
40293465 gtttttgtttgtttgacgcgcatcaatatgaactattgccatacacttattatagaataa 40293406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 662 times since January 2019
Visitors: 2235