View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_5 (Length: 351)
Name: NF0185_low_5
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0185_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 36 - 99
Target Start/End: Complemental strand, 40293560 - 40293497
Alignment:
| Q |
36 |
agttgtaccgttatgttactttggttgatccagcctgcaatcaattcgaatattatgcgtatac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40293560 |
agttgtaccgttatgttactttggttgatccagcctgcaatcaattcgaatattatgcgtatac |
40293497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 40293465 - 40293406
Alignment:
| Q |
219 |
gtttttgtttgtttgacgcgcatcaatatgaactattgccatacacgtattatagaataa |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40293465 |
gtttttgtttgtttgacgcgcatcaatatgaactattgccatacacttattatagaataa |
40293406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 662 times since January 2019
Visitors: 2235