View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0185_low_7 (Length: 329)
Name: NF0185_low_7
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0185_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 86 - 238
Target Start/End: Complemental strand, 35771162 - 35771010
Alignment:
Q |
86 |
tctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgaga |
185 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35771162 |
tctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgaga |
35771063 |
T |
 |
Q |
186 |
tcttgaagcttgttgagtgataaaatagaaggatggatttcacgcagattttt |
238 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35771062 |
tcttgaagcttgtcgagtgataaaatagaaggatggatttcacgcagattttt |
35771010 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 3778 times since January 2019
Visitors: 8726