View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0185_low_7 (Length: 329)

Name: NF0185_low_7
Description: NF0185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0185_low_7
NF0185_low_7
[»] chr3 (1 HSPs)
chr3 (86-238)||(35771010-35771162)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 86 - 238
Target Start/End: Complemental strand, 35771162 - 35771010
Alignment:
Q  86 tctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgaga 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35771162 tctgagagatgagcagttgctgagtgtgatgctttggagagactctaaatgattgtcagtctgaagacttgtaatctttttacaaccttctaattcgaga 35771063  T
Q  186 tcttgaagcttgttgagtgataaaatagaaggatggatttcacgcagattttt 238  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  35771062 tcttgaagcttgtcgagtgataaaatagaaggatggatttcacgcagattttt 35771010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3778 times since January 2019
Visitors: 8726