View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_high_13 (Length: 331)
Name: NF0186_high_13
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 166 - 310
Target Start/End: Complemental strand, 40174489 - 40174345
Alignment:
| Q |
166 |
gaagtggtgttccggtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
265 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174489 |
gaagtggtgttcctgtgtatggtccacctcggcctggcatgccccctccaccaaatgctccaaatcaacaacagcaacagtgattgtagaattgattggt |
40174390 |
T |
|
| Q |
266 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174389 |
atgtttgtttctgttattttgctcttactttgtttgatgatgatg |
40174345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 40174657 - 40174554
Alignment:
| Q |
1 |
ttgggcagagaccaggtggtcctccaccacaatttggtatgccgcctcctcagtatgggcagagaccaatggggccacctcctcctggtcagatggtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40174657 |
ttgggcagagaccaggtggtcctccaccacaatttggtatgccacctcctcagtatgggcagagaccaatggggccacctcctcctggtcagatggtgag |
40174558 |
T |
|
| Q |
101 |
agga |
104 |
Q |
| |
|
|||| |
|
|
| T |
40174557 |
agga |
40174554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 34400973 - 34401057
Alignment:
| Q |
20 |
tcctccaccacaatttggtatgccgcctcctcagtatgggcagagaccaatggggccacctcctcctggtcagatggtgagagga |
104 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||| |||||||| ||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
34400973 |
tcctccgccacaattttccatgccgcctcctcagtttggacagagacctatgggcccacctcctcctggacagatgatgagagga |
34401057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1193 times since January 2019
Visitors: 2246