View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0186_high_17 (Length: 269)

Name: NF0186_high_17
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0186_high_17
NF0186_high_17
[»] chr4 (1 HSPs)
chr4 (28-269)||(54395330-54395571)


Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 28 - 269
Target Start/End: Complemental strand, 54395571 - 54395330
Alignment:
28 ataatatgaggaatacaataaaggatgagaagattggtgggaagttgagtcatgatgataaggagaagattgagaaggctgtggaagatgctatacagtg 127  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||    
54395571 ataatatgaggaatacaattaaggatgagaagattggtgggaagttgagtcatgaagataaggagaagattgagaaggctgtggaagatgcaatacagtg 54395472  T
128 gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54395471 gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt 54395372  T
228 ggtgctggtggagatgtgcctatgggagatggtatgcctggt 269  Q
    ||||||||||||||||||||||||||||||||||||||||||    
54395371 ggtgctggtggagatgtgcctatgggagatggtatgcctggt 54395330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1106 times since January 2019
Visitors: 2244