View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_high_17 (Length: 269)
Name: NF0186_high_17
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0186_high_17 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 28 - 269
Target Start/End: Complemental strand, 54395571 - 54395330
Alignment:
Q |
28 |
ataatatgaggaatacaataaaggatgagaagattggtgggaagttgagtcatgatgataaggagaagattgagaaggctgtggaagatgctatacagtg |
127 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
54395571 |
ataatatgaggaatacaattaaggatgagaagattggtgggaagttgagtcatgaagataaggagaagattgagaaggctgtggaagatgcaatacagtg |
54395472 |
T |
 |
Q |
128 |
gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54395471 |
gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt |
54395372 |
T |
 |
Q |
228 |
ggtgctggtggagatgtgcctatgggagatggtatgcctggt |
269 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54395371 |
ggtgctggtggagatgtgcctatgggagatggtatgcctggt |
54395330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1106 times since January 2019
Visitors: 2244