View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_high_6 (Length: 455)
Name: NF0186_high_6
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 38 - 126
Target Start/End: Complemental strand, 41179279 - 41179189
Alignment:
| Q |
38 |
catcaaatttttaatggtatgttctgtaaaaaga--gcaaatgatttatttaatattttcaaatcttataaaaataattggggcaaggtta |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | | ||||||||||||||||||||||||||||||||||||| ||| || |||||||| |
|
|
| T |
41179279 |
catcaaatttttaatggtatgttatgtaaaaaaaaagaaaatgatttatttaatattttcaaatcttataaaaatgattaggacaaggtta |
41179189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University