View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_11 (Length: 413)
Name: NF0186_low_11
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0186_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 119 - 316
Target Start/End: Complemental strand, 40571276 - 40571079
Alignment:
Q |
119 |
tgtgaacttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgt |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40571276 |
tgtgaacttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgt |
40571177 |
T |
 |
Q |
219 |
ggcgtaggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat |
316 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40571176 |
ggcgtaggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat |
40571079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 140 - 316
Target Start/End: Complemental strand, 40577681 - 40577502
Alignment:
Q |
140 |
tctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgtggcgtaggtttttcgcccaga |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| | |||||| | | |||||||| |||| |||||||||||||||||||||||| | |||| |
|
|
T |
40577681 |
tctcacagcaaccaataccagagcaaggttgattggcttcgatatcatcaagcctgttgcagaaagccacacatcctgtggcgtaggttttttcctcaga |
40577582 |
T |
 |
Q |
240 |
atcagct------gcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat |
316 |
Q |
|
|
||||||| || | | || ||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
40577581 |
atcagcttctccgactgcgagtattcccaccgtgtcacaaccaactgctataaacttgttttgagtt---gagatgtgaaaat |
40577502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 316
Target Start/End: Complemental strand, 40595823 - 40595772
Alignment:
Q |
265 |
gtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat |
316 |
Q |
|
|
|||||||| |||||||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
40595823 |
gtgtcacatccaactgctatcaacttgttttgagttggcgagacgtgaaaat |
40595772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 316
Target Start/End: Complemental strand, 40566583 - 40566392
Alignment:
Q |
125 |
cttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgtggcgta |
224 |
Q |
|
|
||||||||| | |||||| || |||||| |||| ||||||| |||| |||| | ||||||| | | ||||||| |||| ||||||||||||| ||| |
|
|
T |
40566583 |
cttggggtattgaaatctcgcaacaaccagtacctgagcaagattgactggccataatatcatcaagcctgttgcataaagccacacatcctgtggtgta |
40566484 |
T |
 |
Q |
225 |
ggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat |
316 |
Q |
|
|
| | |||| |||||||||| || | | |||| | ||||||||| ||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
T |
40566483 |
gttgtttcccccagaatcaatcgccgagagtgctccaatcgtgtcacagccaactgctgtcaacttgtttcgagttggcgagatgtaaaaat |
40566392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 8490797 - 8490768
Alignment:
Q |
265 |
gtgtcacaaccaactgctatcaacttgttt |
294 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
8490797 |
gtgtcacaaccaactgctatcaacttgttt |
8490768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1198 times since January 2019
Visitors: 2246