View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0186_low_11 (Length: 413)

Name: NF0186_low_11
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0186_low_11
NF0186_low_11
[»] chr3 (4 HSPs)
chr3 (119-316)||(40571079-40571276)
chr3 (140-316)||(40577502-40577681)
chr3 (265-316)||(40595772-40595823)
chr3 (125-316)||(40566392-40566583)
[»] chr5 (1 HSPs)
chr5 (265-294)||(8490768-8490797)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 119 - 316
Target Start/End: Complemental strand, 40571276 - 40571079
Alignment:
119 tgtgaacttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40571276 tgtgaacttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgt 40571177  T
219 ggcgtaggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40571176 ggcgtaggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat 40571079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 140 - 316
Target Start/End: Complemental strand, 40577681 - 40577502
Alignment:
140 tctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgtggcgtaggtttttcgcccaga 239  Q
    |||||||||||||||||||||||||||||||||||||  | ||||||  | |  |||||||| |||| ||||||||||||||||||||||||  | ||||    
40577681 tctcacagcaaccaataccagagcaaggttgattggcttcgatatcatcaagcctgttgcagaaagccacacatcctgtggcgtaggttttttcctcaga 40577582  T
240 atcagct------gcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat 316  Q
    |||||||       || | | || ||||||||||||||||||||||||||| |||||||||| ||||   |||||||||||||    
40577581 atcagcttctccgactgcgagtattcccaccgtgtcacaaccaactgctataaacttgttttgagtt---gagatgtgaaaat 40577502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 316
Target Start/End: Complemental strand, 40595823 - 40595772
Alignment:
265 gtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat 316  Q
    |||||||| |||||||||||||||||||||| ||||||||||| ||||||||    
40595823 gtgtcacatccaactgctatcaacttgttttgagttggcgagacgtgaaaat 40595772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 316
Target Start/End: Complemental strand, 40566583 - 40566392
Alignment:
125 cttggggtaattgaatctcacagcaaccaataccagagcaaggttgattggcgacaatatcagtacgattgttgcagtaagcaacacatcctgtggcgta 224  Q
    ||||||||| |  |||||| || |||||| |||| ||||||| |||| |||| | |||||||  | |  |||||||  |||| ||||||||||||| |||    
40566583 cttggggtattgaaatctcgcaacaaccagtacctgagcaagattgactggccataatatcatcaagcctgttgcataaagccacacatcctgtggtgta 40566484  T
225 ggtttttcgcccagaatcagctgcttctaatactcccaccgtgtcacaaccaactgctatcaacttgtttttagttggcgagatgtgaaaat 316  Q
    | | |||| ||||||||||   ||    | | |||| | ||||||||| ||||||||| |||||||||||  |||||||||||||| |||||    
40566483 gttgtttcccccagaatcaatcgccgagagtgctccaatcgtgtcacagccaactgctgtcaacttgtttcgagttggcgagatgtaaaaat 40566392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 294
Target Start/End: Complemental strand, 8490797 - 8490768
Alignment:
265 gtgtcacaaccaactgctatcaacttgttt 294  Q
    ||||||||||||||||||||||||||||||    
8490797 gtgtcacaaccaactgctatcaacttgttt 8490768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1198 times since January 2019
Visitors: 2246