View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_12 (Length: 373)
Name: NF0186_low_12
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 40571666 - 40571795
Alignment:
| Q |
1 |
tcgtgagattaatcaagttggttttaccaagtttggtttaaaccttcctaccaatgttacaattttttggttttgctccagttctgcctgcagatcttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40571666 |
tcgtgagattaatcaagttggttttaccaagtttggtttaaaccttcctaccaatgttacaattttttggttttgctccagttctgcctgcagatcttag |
40571765 |
T |
 |
| Q |
101 |
aaatattgtctttcctagagcttttaattg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40571766 |
aaatattgtctttcctagagcttttaattg |
40571795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 192 - 275
Target Start/End: Original strand, 40571855 - 40571936
Alignment:
| Q |
192 |
taagattttaaaacaactgtatgatttttctcaagtgacatattatacttttcttgaaaattagttagctaaagacactcagtg |
275 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40571855 |
taagattttaaaact--tgtatgatttttctcaagtgacatattatacttttcttgaaaattagttagctaaagacactcagtg |
40571936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 40578087 - 40578230
Alignment:
| Q |
1 |
tcgtgagattaatcaagttggttttaccaagtttggtttaaaccttcctaccaatgttacaattttttggttttgctcc---------------agttct |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |||||||||||||||| |||| ||||||| |||||||||| |||||| |
|
|
| T |
40578087 |
tcgtgagattaaccaagttggttttacgaagtttggtctaaaccttcctaccaaagttatgatttttt-gttttgctccagaatttatcgctctagttct |
40578185 |
T |
 |
| Q |
86 |
gcctgcagatcttagaaatattgtctttcctagagcttttaattg |
130 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
40578186 |
gcctgcagatcttagaaatgtattctttcctagagcttttaattg |
40578230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University