View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_16 (Length: 325)
Name: NF0186_low_16
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0186_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 100 - 215
Target Start/End: Complemental strand, 54238564 - 54238453
Alignment:
Q |
100 |
ttacaggcacgaaaactttctcaccagtaatattatgttcttcatcaaatccaaccttcctattatttccttccttcccttcaaactcaattttctccaa |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
54238564 |
ttacaggcacgaaaactttctcaccagtaatattatgttcttcatcaaatccaaccttcctattatttcc----ttcccttcaaactcaattttctccaa |
54238469 |
T |
 |
Q |
200 |
gaatcttgcatttgtg |
215 |
Q |
|
|
|||||||||||||||| |
|
|
T |
54238468 |
gaatcttgcatttgtg |
54238453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 32 - 78
Target Start/End: Complemental strand, 54238635 - 54238589
Alignment:
Q |
32 |
ataatactgtggcggaataataaattatgtgtgaatgctatataatc |
78 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54238635 |
ataatactgtggcggaataataaattatgtgtgaatgctatataatc |
54238589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University