View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_19 (Length: 313)
Name: NF0186_low_19
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 27 - 313
Target Start/End: Original strand, 29056990 - 29057277
Alignment:
| Q |
27 |
gttgttatcggtggtggcggagttaagcgtagccgtggccattgaaggaaggttctagaagtcgtggagaacagcgcgcgagagtttcaagagagtggtg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29056990 |
gttgttatcggtggtggcggagttaagcgtagccgtggccattgaaggaaggttctagaagtcgtggagaatagcgcgcgagagtttcaagagagtggtg |
29057089 |
T |
|
| Q |
127 |
gtggtttaatcggttatgatgaggcgggggaagagatcgatggggtttgtgtttttggctgtttgtaatttggaattggattttttccacggttaaacac |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||| | ||||||||||||||||||||||||||| ||||| |||| || |
|
|
| T |
29057090 |
gtggtttaatcggttatgatgaggcggttgaagagatcgatggtgtttgtgttttggactgtttgtaatttggaattggatttttcccacgtttaagca- |
29057188 |
T |
|
| Q |
227 |
cggat-tggtccgt-cgattttaaatgggtactttagatcatttatgggtaaatttgtggttggaaatattaattgtttgttttcatat |
313 |
Q |
| |
|
||||| |||||||| |||||| |||||| ||||| |||||||||||| ||||| ||||| |||||||||| ||||||||| | |||||| |
|
|
| T |
29057189 |
cggatctggtccgtccgatttcaaatggatacttgagatcatttatgcgtaaaattgtgtttggaaatatgaattgtttgatctcatat |
29057277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1146 times since January 2019
Visitors: 2244