View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0186_low_19 (Length: 313)

Name: NF0186_low_19
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0186_low_19
NF0186_low_19
[»] chr3 (1 HSPs)
chr3 (27-313)||(29056990-29057277)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 27 - 313
Target Start/End: Original strand, 29056990 - 29057277
Alignment:
27 gttgttatcggtggtggcggagttaagcgtagccgtggccattgaaggaaggttctagaagtcgtggagaacagcgcgcgagagtttcaagagagtggtg 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
29056990 gttgttatcggtggtggcggagttaagcgtagccgtggccattgaaggaaggttctagaagtcgtggagaatagcgcgcgagagtttcaagagagtggtg 29057089  T
127 gtggtttaatcggttatgatgaggcgggggaagagatcgatggggtttgtgtttttggctgtttgtaatttggaattggattttttccacggttaaacac 226  Q
    |||||||||||||||||||||||||||  |||||||||||||| ||||||||||| | ||||||||||||||||||||||||||| ||||| |||| ||     
29057090 gtggtttaatcggttatgatgaggcggttgaagagatcgatggtgtttgtgttttggactgtttgtaatttggaattggatttttcccacgtttaagca- 29057188  T
227 cggat-tggtccgt-cgattttaaatgggtactttagatcatttatgggtaaatttgtggttggaaatattaattgtttgttttcatat 313  Q
    ||||| |||||||| |||||| |||||| ||||| |||||||||||| ||||| ||||| |||||||||| ||||||||| | ||||||    
29057189 cggatctggtccgtccgatttcaaatggatacttgagatcatttatgcgtaaaattgtgtttggaaatatgaattgtttgatctcatat 29057277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University